TPP Riboswitch activator | BI-5232

Riboswitches are small, structured RNA molecules, consisting of a ligand-sensing aptamer domain joined to a ribozyme domain, which regulates gene expression in response to aptamer binding. Riboswitches are promising tools to regulate gene expression for scientific and, potentially, therapeutic purposes¹. However, there remains a demand for orthogonal, i.e., engineered aptamers that bind drug-like ligands without being activated by the native activators. Such synthetic riboswitches hold the potential to display inducible activity.

The TPP riboswitch class was one of the earliest riboswitches identified² and is the most widespread riboswitch in nature, being distributed among archaebacteria, eubacteria as well as eukaryotes^3,4,5. Especially the Escherichia coli thiM aptamer has been studied intensively and has been the subject of several structural and mechanistic studies providing insights into the mechanism of ligand binding⁶. It is composed of two helical sections connected via a three-way junction to a closing stem that is stabilized upon binding of the natural ligand, thiamine pyrophosphate^6,7. TPP acts as a bridge that connects the two helical regions and locks them in a ‘Y-shape’^6,7. TPP is an active form of vitamin B1, an essential participant in many protein-catalysed reactions. The TPP-sensing riboswitch, controls genes responsible for importing or synthesizing thiamine and its phosphorylated derivatives. Structure-guided randomization of a specific binding region of the thiM aptamer, led to an aptamer that binds BI-5232 with very high selectivity, while its natural ligand TPP could no longer bind⁸.

BI-5232 is a drug-like non-natural ligand of the thiM aptamer of the TPP riboswitch with potencies near equal to TPP itself. It has been shown to cellularly induce transgene expression in constructs using both the native aptamer as well as the site-directed mutant which does not bind TPP. It therefore represents a tool compound for both the native as well as the orthogonal riboswitch. Further research is warranted to come up with a fully “synthetic toolbox for conditionally controlling gene expression with potential applications in next-generation gene therapies”⁸.

Structural model of the active complex of BI-5232 bound to the native TPP riboswitch⁸

^aAssay conditions: SPR binding to native thiM TPP riboswitch.

Surface Plasmon Resonance experiments were carried out at 25 °C on a BiacoreT200 instrument. Immobilization of a single stranded DNA (5’-CGTCGCAGATCGTGTCTTCC[Am C7) to CM5 chips (Cytiva) was performed as described by Liu et al.⁸ RNA was captured via the single stranded oligonucleotide. The utilized RNA (in vitro transcribed and PAGE purified) consists of the natural TPP aptamer sequence from the thiM riboswitch⁷, a short linker (U3) and a hybridization sequence complementary to the immobilized  DNA ( 5´ TAATACGACTCACTATAGGAAGACACGATCTGCGACGTTTGCGACTCGGGGTGCCCTTCTGCGTGAAGGCTGAGAAATACCCGTATCACCTGATCTGGATAATGCCAGCGTAGGGAAGTCGC 3´). As a control, a TPP aptamer with an inactivating G40C mutation was used.

Binding assays were performed with a flow rate of 30 μL/min in 10 mM HEPES pH 7.4, 100 mM NaCl, 50 mM KCl, 5 mM MgCl₂, 0.05 % (v/v) Tween 20, 2 % (v/v) DMSO. Compounds were tested in a single cycle experiment at five different concentrations (e.g. 320 nM, 1.6 μM, 8 μM, 40 μM, 200 μM), with 2 min association and a final dissociation time of 15 min. For regeneration, 50 mM EDTA was used. TPP was used at concentrations of 625 pM, 1,25 nM, 2,5 nM, 5 nM and 10 nM).

Sensorgrams were evaluated using Biacore T200 Evaluation Software. The responses at the different concentrations were either fitted using a steady state affinity model or by direct curve fitting using a 1:1 interaction model to determine the KD value as well as kinetic parameters (ka and kd).

BI-5232 is a soluble compound with good properties, suitable for use in cell assays including moderate permeability and low efflux in the MDCK PGP cell line, and low microsomal clearance in rat and human.

BI-5209, a structurally very close analogue, is available as a negative control.

BI-5209, which serves as a negative control

BI-5232 inhibits MU/H, 5HT2B/H AG, 5HT1A/H, 5HT3/H, M3/H, M2/ and M1H with 55, 62, 64, 77, 86, 86 and 92% @10µM respectively. All other targets measured in the SafetyScreen44 are below 50% inhibition. Compounds are considered selective, if they do not hit any of the measured targets in the SafetyScreen44™ > 50%; panel measured at 10 µM.

SELECTIVITY DATA AVILABLE	BI-5232	BI-5209
SafetyScreen44™ with kind support of	Yes	Ongoing
Invitrogen®	No	No
DiscoverX®	No	No
Dundee	No	No

Download selectivity data:   
BI-5232_selectivityData.xlsx

BI-5232 is a drug-like high affinity activator of the thiamine pyrophosphate (TPP) riboswitch. It has demonstrated activity both against the native TPP riboswitch and an orthogonal variant that can no longer be activated by its natural ligand.

2 D structure formats available

TPP Riboswitch activator | BI-5232.png

TPP Riboswitch activator | BI-5232.smiles

TPP Riboswitch activator | BI-5232.sdf

Negative control | BI-5209.png

Negative control | BI-5209.smiles

Negative control | BI-5209.sdf

When you plan a publication, please use the following acknowledgement:  
BI-5232 was kindly provided by Boehringer Ingelheim via its open innovation platform opnMe, available at https://opnme.com.

Reference RIS format

Reference txt format